Indexed by:
Abstract:
The PML::RAR alpha fusion gene resulting from the t(15;17) chromosomal translocation serves as the pathognomonic molecular marker of acute promyelocytic leukemia (APL), which has been shown to directly repress transcription of retinoic acid (RA)-responsive genes, ultimately inducing granulocytic differentiation arrest. In this study, we report an APL case harboring an atypical PML::RAR alpha fusion transcript characterized by a novel splice site variant (GCCaggccc) within PML exon 6, resulting in an 80 base pairs deletion of the distal exonic sequence with concomitant insertion of 23 exogenous nucleotides (agagccttcttctctctgggacaag). To our knowledge, this isoform differs from all previously described PML::RAR alpha fusion transcripts. This case emphasizes the importance of molecular characterization in APL diagnosis and minimal residual disease (MRD) monitoring, though further studies are required to establish its clinical correlation.
Keyword:
Reprint 's Address:
Email:
Source :
ANNALS OF HEMATOLOGY
ISSN: 0939-5555
Year: 2025
3 . 0 0 0
JCR@2023
Cited Count:
SCOPUS Cited Count:
ESI Highly Cited Papers on the List: 0 Unfold All
WanFang Cited Count:
Chinese Cited Count:
30 Days PV: 0
Affiliated Colleges: