• Complex
  • Title
  • Keyword
  • Abstract
  • Scholars
  • Journal
  • ISSN
  • Conference
成果搜索

author:

Chen, Haimin (Chen, Haimin.) [1] | Chen, Meihong (Chen, Meihong.) [2] | Yang, Zhongjie (Yang, Zhongjie.) [3] | Liao, Shuzhen (Liao, Shuzhen.) [4] | Lin, Yun (Lin, Yun.) [5] | Yan, Linlin (Yan, Linlin.) [6]

Indexed by:

SCIE

Abstract:

The PML::RAR alpha fusion gene resulting from the t(15;17) chromosomal translocation serves as the pathognomonic molecular marker of acute promyelocytic leukemia (APL), which has been shown to directly repress transcription of retinoic acid (RA)-responsive genes, ultimately inducing granulocytic differentiation arrest. In this study, we report an APL case harboring an atypical PML::RAR alpha fusion transcript characterized by a novel splice site variant (GCCaggccc) within PML exon 6, resulting in an 80 base pairs deletion of the distal exonic sequence with concomitant insertion of 23 exogenous nucleotides (agagccttcttctctctgggacaag). To our knowledge, this isoform differs from all previously described PML::RAR alpha fusion transcripts. This case emphasizes the importance of molecular characterization in APL diagnosis and minimal residual disease (MRD) monitoring, though further studies are required to establish its clinical correlation.

Keyword:

Acute promyelocytic leukemia (APL) Atypical fusion PML:RARalpha fusion gene Splice variant

Community:

  • [ 1 ] [Chen, Haimin]Fuzhou Univ, Affiliated Prov Hosp, Dept Clin Lab, Fuzhou, Peoples R China
  • [ 2 ] [Chen, Meihong]Fuzhou Univ, Affiliated Prov Hosp, Dept Clin Lab, Fuzhou, Peoples R China
  • [ 3 ] [Liao, Shuzhen]Fuzhou Univ, Affiliated Prov Hosp, Dept Clin Lab, Fuzhou, Peoples R China
  • [ 4 ] [Yang, Zhongjie]Fujian Med Univ, Dept Clin Lab, Zhangzhou Affiliated Hosp, Zhangzhou, Peoples R China
  • [ 5 ] [Lin, Yun]Fuzhou Univ, Dept Hematol, Affiliated Prov Hosp, Fuzhou, Peoples R China
  • [ 6 ] [Yan, Linlin]Fuzhou Univ, Affiliated Prov Hosp, Dept Transfus, Fuzhou, Peoples R China

Reprint 's Address:

  • [Lin, Yun]Fuzhou Univ, Dept Hematol, Affiliated Prov Hosp, Fuzhou, Peoples R China;;[Yan, Linlin]Fuzhou Univ, Affiliated Prov Hosp, Dept Transfus, Fuzhou, Peoples R China

Show more details

Related Keywords:

Source :

ANNALS OF HEMATOLOGY

ISSN: 0939-5555

Year: 2025

3 . 0 0 0

JCR@2023

Cited Count:

WoS CC Cited Count:

SCOPUS Cited Count:

ESI Highly Cited Papers on the List: 0 Unfold All

WanFang Cited Count:

Chinese Cited Count:

30 Days PV: 0

Online/Total:1600/13868529
Address:FZU Library(No.2 Xuyuan Road, Fuzhou, Fujian, PRC Post Code:350116) Contact Us:0591-22865326
Copyright:FZU Library Technical Support:Beijing Aegean Software Co., Ltd. 闽ICP备05005463号-1